DC Field | Value | Language |
---|---|---|
dc.contributor.author | Lim, HM | - |
dc.contributor.author | Cho, JI | - |
dc.contributor.author | Lee, S | - |
dc.contributor.author | Cho, MH | - |
dc.contributor.author | Bhoo, SH | - |
dc.contributor.author | An, G | - |
dc.contributor.author | Hahn, TR | - |
dc.contributor.author | Jeon, JS | - |
dc.date.accessioned | 2016-04-01T01:39:30Z | - |
dc.date.available | 2016-04-01T01:39:30Z | - |
dc.date.created | 2009-08-07 | - |
dc.date.issued | 2007-05 | - |
dc.identifier.issn | 0721-7714 | - |
dc.identifier.other | 2007-OAK-0000006818 | - |
dc.identifier.uri | https://oasis.postech.ac.kr/handle/2014.oak/23419 | - |
dc.description.abstract | Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFP alpha genes were analyzed using transgenic plants containing a promoter::beta-glucuronidase (GUS) fusion construct. Whereas the AtPFP alpha 1 promoter was found to be ubiquitously active in all tissues, the AtPFP alpha 2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFP alpha 2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFP alpha 2 and which is essential for AtPFP alpha 2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFP alpha 2 is sufficient for normal AtPFP alpha 2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFP alpha 2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes. | - |
dc.description.statementofresponsibility | X | - |
dc.language | English | - |
dc.publisher | SPRINGER | - |
dc.relation.isPartOf | PLANT CELL REPORTS | - |
dc.subject | GUS | - |
dc.subject | PFP alpha 2 | - |
dc.subject | promoter | - |
dc.subject | pyrophosphate | - |
dc.subject | fructose-6-phosphate 1-phosphotransferase | - |
dc.subject | trichome | - |
dc.subject | STRONGLY DECREASED EXPRESSION | - |
dc.subject | DEPENDENT PHOSPHOFRUCTOKINASE | - |
dc.subject | ALPHA-SUBUNIT | - |
dc.subject | TRANSCRIPTION FACTORS | - |
dc.subject | POTATO-TUBER | - |
dc.subject | PLANTS | - |
dc.subject | PROMOTER | - |
dc.subject | METABOLISM | - |
dc.subject | FRUCTOSE-2,6-BISPHOSPHATE | - |
dc.subject | PHOSPHOTRANSFERASE | - |
dc.title | Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate : fructose-6-phosphate 1-phosphotransferase alpha 2 gene that is essential for expression | - |
dc.type | Article | - |
dc.contributor.college | 생명과학과 | - |
dc.identifier.doi | 10.1007/s00299-006-0272-9 | - |
dc.author.google | Lim, HM | - |
dc.author.google | Cho, JI | - |
dc.author.google | Lee, S | - |
dc.author.google | Cho, MH | - |
dc.author.google | Bhoo, SH | - |
dc.author.google | An, G | - |
dc.author.google | Hahn, TR | - |
dc.author.google | Jeon, JS | - |
dc.relation.volume | 26 | - |
dc.relation.issue | 5 | - |
dc.relation.startpage | 683 | - |
dc.relation.lastpage | 692 | - |
dc.contributor.id | 10184525 | - |
dc.relation.journal | PLANT CELL REPORTS | - |
dc.relation.index | SCI급, SCOPUS 등재논문 | - |
dc.relation.sci | SCI | - |
dc.collections.name | Journal Papers | - |
dc.type.rims | ART | - |
dc.identifier.bibliographicCitation | PLANT CELL REPORTS, v.26, no.5, pp.683 - 692 | - |
dc.identifier.wosid | 000246100100015 | - |
dc.date.tcdate | 2019-01-01 | - |
dc.citation.endPage | 692 | - |
dc.citation.number | 5 | - |
dc.citation.startPage | 683 | - |
dc.citation.title | PLANT CELL REPORTS | - |
dc.citation.volume | 26 | - |
dc.contributor.affiliatedAuthor | An, G | - |
dc.identifier.scopusid | 2-s2.0-34247624679 | - |
dc.description.journalClass | 1 | - |
dc.description.journalClass | 1 | - |
dc.description.wostc | 5 | - |
dc.type.docType | Article | - |
dc.subject.keywordPlus | STRONGLY DECREASED EXPRESSION | - |
dc.subject.keywordPlus | DEPENDENT PHOSPHOFRUCTOKINASE | - |
dc.subject.keywordPlus | ALPHA-SUBUNIT | - |
dc.subject.keywordPlus | TRANSCRIPTION FACTORS | - |
dc.subject.keywordPlus | POTATO-TUBER | - |
dc.subject.keywordPlus | PLANTS | - |
dc.subject.keywordPlus | PROMOTER | - |
dc.subject.keywordPlus | METABOLISM | - |
dc.subject.keywordPlus | FRUCTOSE-2,6-BISPHOSPHATE | - |
dc.subject.keywordPlus | PHOSPHOTRANSFERASE | - |
dc.subject.keywordAuthor | GUS | - |
dc.subject.keywordAuthor | PFP alpha 2 | - |
dc.subject.keywordAuthor | promoter | - |
dc.subject.keywordAuthor | pyrophosphate | - |
dc.subject.keywordAuthor | fructose-6-phosphate 1-phosphotransferase | - |
dc.subject.keywordAuthor | trichome | - |
dc.relation.journalWebOfScienceCategory | Plant Sciences | - |
dc.description.journalRegisteredClass | scie | - |
dc.description.journalRegisteredClass | scopus | - |
dc.relation.journalResearchArea | Plant Sciences | - |
Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.
library@postech.ac.kr Tel: 054-279-2548
Copyrights © by 2017 Pohang University of Science ad Technology All right reserved.